Comparing a Sequence of Interest to Your Competitors

In this workflow, we are using the Multi-Sequence Alignment tool to compare a sequence of interest taken from Regeneron Pharmaceuticals Inc. with sequences from their competitor, Pfizer. We start in a workspace where we add our sequence of interest, then go into Analytics to extract sequences from Pfizer's patents, and finally proceed to the Multi-Sequence Alignment tool to begin our analysis.

Importing the Sequence into a Workspace

Starting on the workspace page, we will create a new workspace for our comparison:

I've labeled the workspace as "Sequence Comparison" and the subfolder as "Pfizer," as we'll be focusing on the comparison of Pfizer's sequences. To proceed, go to the "Sequence" tab and select "Import Sequence." Paste the provided sequence into the designated area.

CAGGTGCAGCTGGTGGAGTCTGGGGGAGGCGTGGTCCAGCCTGGGAGGTCCCTGAGACTCTCCTGTGCAGCGTCTGGATTCACCTTCAGTAGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGCAAGGGGCTGGAGTGGGTGGCAGTTATATGGTATGATGGAAGTAATAAATACTATGCAGACTCCGTGAAGGGCCGATTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCTGTGTATTACTGTGCGAGAGATGGATATAGTGGCTACGATGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCCTCA

Extracting Sequences from Pfizer Patents

Navigate to Analytics and search for Pfizer using either Field search or Simple search:

Upon reaching the results page, our next step involves refining the patent results using the filters located on the left-hand side of the page. To focus solely on Active US patents, we will employ the "Authority" and "Simple Legal Status" filters. This will effectively narrow down our results to a total of 341 patents:

Select all the patents and click on "Extract Sequences" in the pop-up that appears:

Please note that you can pick 100 patents from a single page and will need to navigate through the other pages sequentially to select all 341 patents.

You will have the option to extract sequences mentioned only in the claims, which is what we will do:

While on the Bio Extraction page, access the "Sequence Type" filter located on the left-hand side of the page. This filter is used to narrow down our sequences specifically to Nucleotides, considering that the sequence of interest we previously imported falls into this category.

Select all the sequences and click "Save Sequence" in the pop-up that appears to save them to the workspace folder we created earlier.

Once the sequences have been saved, return to the workspace that we created in order to begin our comparison.

Comparing Sequences using the Multi Sequence Alignment Tool

Upon reaching the "Sequence" tab within our designated workspace, proceed to choose the initial set of 100 sequences. Subsequently, click on "Align Sequences" within the displayed pop-up. Please take into consideration that it's possible to align only 100 sequences in a single instance. Ensure that the sequence of interest is consistently included in the alignment if you will align more than 100 sequences.

After arriving at the Alignment page, opt for the "Pair-Seq Alignment" button, given our intention to compare the sequence from Regeneron Pharmaceuticals with all the Pfizer sequences we saved. Ensure that you designate the sequence of interest as your "template sequence."

To view the alignment results, click on the "View all Alignments" button located near the bottom right of the screen:

You can then save your report to view later by clicking on the "Save as" or "Save" button:

You can access saved reports by navigating to the homepage of Bio and clicking on the "Alignment Report" tab:

Overall, this workflow serves as a practical guide for sequence comparison, enabling researchers and other individuals to make insightful comparisons between sequences of interest from their own organizations with different competitors, thereby contributing to the advancement of various research endeavors.